pERM2-nhpSer
(Plasmid
#201922)
-
PurposeEnables translational incorporation of non-hydrolyzable phosphoserine into proteins at TAG codons in E coli. Do not use for phosphoserine incorporation.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201922 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCustom
-
Backbone manufacturerN/A
- Total vector size (bp) 9754
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsPropagate with 0.5% (w/v) glucose
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSepRS(2)
-
SpeciesMethanococcus maripaludis
-
Insert Size (bp)1617
-
MutationE412P, E414F, T417K, P495M, I496W, F529S
-
GenBank IDWP_011170632
- Promoter GlnS (constitutive)
-
Tag
/ Fusion Protein
- None
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CGACATCTTGGACCATTAGCCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSep-tRNA v2.0
-
SpeciesMethanococcus maripaludis
-
Insert Size (bp)75
- Promoter lpp (constitutive)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CTAGAACCGGAAGGAGCTACCG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameSerB
-
SpeciesE. coli
-
Insert Size (bp)970
- Promoter OXB20 (constitutive)
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer CCCGGCAGATCTTTGTCGATC (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameEF-Sep
-
SpeciesE. coli
-
Insert Size (bp)1185
-
MutationH67R , E216N, D217G, F219Y, T229S, N274W
- Promoter tac (lactose/IPTG inducible)
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer ATACCCACGCCGAAACAAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid should be paired with pCDF-Frb-v1 (#201923, which enables the biosynthesis of non-hydrolyzable phosphoserine) and a compatible plasmid expressing protein of interest (e.g. #174076 for a sfGFP-150TAG control) in the cell line BL21(DE3) deltaSerC (#197656). This system is used to translationally incorporate non-hydrolyzable phosphoserine into target proteins at TAG amber stop codons in E coli.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pERM2-nhpSer was a gift from Richard Cooley & Ryan Mehl (Addgene plasmid # 201922 ; http://n2t.net/addgene:201922 ; RRID:Addgene_201922) -
For your References section:
Autonomous Synthesis of Functional, Permanently Phosphorylated Proteins for Defining the Interactome of Monomeric 14-3-3zeta. Zhu P, Stanisheuski S, Franklin R, Vogel A, Vesely CH, Reardon P, Sluchanko NN, Beckman JS, Karplus PA, Mehl RA, Cooley RB. ACS Cent Sci. 2023 Apr 10;9(4):816-835. doi: 10.1021/acscentsci.3c00191. eCollection 2023 Apr 26. 10.1021/acscentsci.3c00191 PubMed 37122473