PX458-3xHA-en15FnCas9
(Plasmid
#201948)
-
PurposeMammalian expression plasmid of enhanced activity FnCas9 variant en15FnCas9 with T2A-EGFP and cloning backbone for sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201948 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePX458
- Backbone size w/o insert (bp) 4233
- Total vector size (bp) 10089
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name3xHA-NLS-en15FnCas9-T2A-EGFP
-
SpeciesSynthetic
-
Insert Size (bp)5856
-
MutationE1603H on FnCas9
- Promoter Cbh
-
Tags
/ Fusion Proteins
- 3xHA (N terminal on insert)
- NLS (N terminal on insert)
- NLS (C terminal on insert)
- T2A-EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site FseI (not destroyed)
- 5′ sequencing primer CTCCGGGCTGTAATTAGCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX458-3xHA-en15FnCas9 was a gift from Debojyoti Chakraborty (Addgene plasmid # 201948 ; http://n2t.net/addgene:201948 ; RRID:Addgene_201948) -
For your References section:
PAM-flexible Engineered FnCas9 variants for robust and ultra-precise genome editing and diagnostics. Acharya S, Ansari AH, Kumar Das P, Hirano S, Aich M, Rauthan R, Mahato S, Maddileti S, Sarkar S, Kumar M, Phutela R, Gulati S, Rahman A, Goel A, Afzal C, Paul D, Agrawal T, Pulimamidi VK, Jalali S, Nishimasu H, Mariappan I, Nureki O, Maiti S, Chakraborty D. Nat Commun. 2024 Jun 28;15(1):5471. doi: 10.1038/s41467-024-49233-w. 10.1038/s41467-024-49233-w PubMed 38942756