pAAV-DIO-CAG-hM4Di-P2A-dTomato
(Plasmid
#202037)
-
PurposeAAV-mediated, cre-dependent expression of the pharmacogenetic actuator hM4Di-2A-dTomato
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202037 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5062
- Total vector size (bp) 7324
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehM4Di
-
SpeciesSynthetic
-
Insert Size (bp)2232
- Promoter CAG
-
Tag
/ Fusion Protein
- dTomato (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer cctacagctcctgggcaacgtgc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBrian Roth
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-DIO-CAG-hM4Di-P2A-dTomato was a gift from Yoav Ben-Simon & Peter Jonas (Addgene plasmid # 202037 ; http://n2t.net/addgene:202037 ; RRID:Addgene_202037)