Skip to main content

pAAV-CaMKII-JEDI-1P-Kv-WPRE
(Plasmid #202614)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202614 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-CaMKIIa
  • Backbone size w/o insert (bp) 5361
  • Total vector size (bp) 6876
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    JEDI-1P-Kv
  • Insert Size (bp)
    1515
  • Promoter CaMKIIa

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATGCTGACGAAGGCTCGCGA
  • 3′ sequencing primer CATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.08.29.505018 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKII-JEDI-1P-Kv-WPRE was a gift from Francois St-Pierre (Addgene plasmid # 202614 ; http://n2t.net/addgene:202614 ; RRID:Addgene_202614)
  • For your References section:

    Widefield imaging of rapid pan-cortical voltage dynamics with an indicator evolved for one-photon microscopy. Lu X, Wang Y, Liu Z, Gou Y, Jaeger D, St-Pierre F. Nat Commun. 2023 Oct 12;14(1):6423. doi: 10.1038/s41467-023-41975-3. 10.1038/s41467-023-41975-3 PubMed 37828037