pSELIS-RamR
(Plasmid
#202631)
-
PurposeEnables dual growth and fluorescence based enrichment of RamR biosensors
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202631 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSELIS
- Total vector size (bp) 5966
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSh ble
-
SpeciesSynthetic
-
Insert Size (bp)375
-
GenBank IDCAA37050.1
- Promoter Lambda promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGACGGTTATTGGAGGAGGTTgacat
- 3′ sequencing primer ggattaataatctggctttttatattctctcttta (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSELIS-RamR was a gift from Andrew Ellington (Addgene plasmid # 202631 ; http://n2t.net/addgene:202631 ; RRID:Addgene_202631) -
For your References section:
Using fungible biosensors to evolve improved alkaloid biosyntheses. d'Oelsnitz S, Kim W, Burkholder NT, Javanmardi K, Thyer R, Zhang Y, Alper HS, Ellington AD. Nat Chem Biol. 2022 Jul 7. pii: 10.1038/s41589-022-01072-w. doi: 10.1038/s41589-022-01072-w. 10.1038/s41589-022-01072-w PubMed 35799063