pLX304-CAG-jAspSnFR3-mRuby3
(Plasmid
#203500)
-
PurposejAspSnFR3-mRuby3 in lentiviral expression vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203500 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLX304-CAG
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namejAspSnFR3-mRuby3
-
Insert Size (bp)2355
- Promoter CAG
-
Tags
/ Fusion Proteins
- mRuby3 (C terminal on insert)
- His-tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cggggttattaatagtaatcaa
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains a N83K mutation in BSD. This mutation is not known to affect plasmid function.
Please visit https://doi.org/10.1101/2023.06.27.546775 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX304-CAG-jAspSnFR3-mRuby3 was a gift from Lucas Sullivan (Addgene plasmid # 203500 ; http://n2t.net/addgene:203500 ; RRID:Addgene_203500) -
For your References section:
An engineered biosensor enables dynamic aspartate measurements in living cells. Davidsen K, Marvin JS, Aggarwal A, Brown TA, Sullivan LB. eLife. 2024 Feb 23;12:RP90024. doi: 10.7554/eLife.90024. 10.7554/eLife.90024 PubMed 38393319