Skip to main content
Addgene

PCDH-Mut-ALKBH5-3xFLAG
(Plasmid #203737)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 203737 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PCDH
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ALKBH5
  • Species
    H. sapiens (human)
  • Mutation
    Enzyme Inactive Mutation (H226A)
  • GenBank ID
    54890
  • Entrez Gene
    ALKBH5 (a.k.a. ABH5, OFOXD, OFOXD1)
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XBAI (unknown if destroyed)
  • 3′ cloning site BAMHI (unknown if destroyed)
  • 5′ sequencing primer TTTCTCTGGTGTGGTTCTGG
  • 3′ sequencing primer AAGTCTTAGTCTTCCCAGGATTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PCDH-Mut-ALKBH5-3xFLAG was a gift from Jianjun Chen (Addgene plasmid # 203737 ; http://n2t.net/addgene:203737 ; RRID:Addgene_203737)
  • For your References section:

    RNA Demethylase ALKBH5 Selectively Promotes Tumorigenesis and Cancer Stem Cell Self-Renewal in Acute Myeloid Leukemia. Shen C, Sheng Y, Zhu AC, Robinson S, Jiang X, Dong L, Chen H, Su R, Yin Z, Li W, Deng X, Chen Y, Hu YC, Weng H, Huang H, Prince E, Cogle CR, Sun M, Zhang B, Chen CW, Marcucci G, He C, Qian Z, Chen J. Cell Stem Cell. 2020 Jul 2;27(1):64-80.e9. doi: 10.1016/j.stem.2020.04.009. Epub 2020 May 12. 10.1016/j.stem.2020.04.009 PubMed 32402250