pT5_TRE-ARID1A-FLAG_PGK-H2B-RFP
(Plasmid
#203965)
-
PurposeDox inducible FLAG tag ARID1a in a sleeping beauty transposon construct
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 203965 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePT5
- Total vector size (bp) 12855
-
Vector typeMammalian Expression ; SLEEPING BEAUTY TRANSPOSON
-
Selectable markersRFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameARID1A
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)6841
-
GenBank IDNM_001080819.2
-
Entrez GeneArid1a (a.k.a. 1110030E03Rik, BAF250, BAF250a, Osa1, Smarcf1)
- Promoter TRE
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gatcgcctggagacgccatc
- 3′ sequencing primer GGCTGCCTTGGAAAAGGCGCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT5_TRE-ARID1A-FLAG_PGK-H2B-RFP was a gift from Elaine Fuchs (Addgene plasmid # 203965 ; http://n2t.net/addgene:203965 ; RRID:Addgene_203965) -
For your References section:
The pioneer factor SOX9 competes for epigenetic factors to switch stem cell fates. Yang Y, Gomez N, Infarinato N, Adam RC, Sribour M, Baek I, Laurin M, Fuchs E. Nat Cell Biol. 2023 Jul 24. doi: 10.1038/s41556-023-01184-y. 10.1038/s41556-023-01184-y PubMed 37488435