pH2rU3_ForInd_Omicron_sinobiological_Spiked21_T7_CMV_ZsGT2APurR
(Plasmid
#204146)
-
PurposeLentivirus backbone with BA.1 spike under an inducible promoter and constitutive expressed zsGreen-T2A-PuR genes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204146 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepH2rU3
- Total vector size (bp) 12403
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSARS-CoV-2 BA.1 variant spike
-
SpeciesSARS-CoV-2
-
Insert Size (bp)3757
-
Mutation21 amino acid cytoplasmic tail deletion
- Promoter TRE3G
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer cagccgagccacatcgc
- 3′ sequencing primer gttatgtaacgcggaactccactagg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namezsGreen-T2A-PuR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1365
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer ccgtcagatcgcctggagac
- 3′ sequencing primer ccacatagcgtaaaaggagcaacatag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pH2rU3_ForInd_Omicron_sinobiological_Spiked21_T7_CMV_ZsGT2APurR was a gift from Jesse Bloom (Addgene plasmid # 204146 ; http://n2t.net/addgene:204146 ; RRID:Addgene_204146) -
For your References section:
A pseudovirus system enables deep mutational scanning of the full SARS-CoV-2 spike. Dadonaite B, Crawford KHD, Radford CE, Farrell AG, Yu TC, Hannon WW, Zhou P, Andrabi R, Burton DR, Liu L, Ho DD, Chu HY, Neher RA, Bloom JD. Cell. 2023 Mar 16;186(6):1263-1278.e20. doi: 10.1016/j.cell.2023.02.001. Epub 2023 Feb 13. 10.1016/j.cell.2023.02.001 PubMed 36868218