pH2rU3_ForInd_mCherry_CMV_ZsGT2APurR
(Plasmid
#204579)
-
Purposelentivirus backbone cloning vector and template for barcoded non-neutralizable standard production
-
Depositing Lab
-
Depositing OrganizationFred Hutchinson Cancer Center
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204579 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepH2rU3
- Total vector size (bp) 9340
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
Insert Size (bp)711
- Promoter TRE3G
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer cagccgagccacatcgc
- 3′ sequencing primer gttatgtaacgcggaactccactagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For cloning lentiviral entry proteins into this plasmid digest it with MluI and AscI enzymes and use HiFi reaction to clone in the viral protein.
For making non-neutralizible standard you need to first barcode mCherry gene. To do so amplify mChery from the backbone using forward (CAGCCGAGCCACATCGCTC)
and reverse (CGGAAGAGCGTCGTGTAGGGAAAG) primers and gel purify the product. Use the product to barcode the mCherry gene using forward primer (gcacgcgCAGCCGAGCCACATCGCTCA) and one if reverse the primers containing unique barcodes. (gcggaactccactaggaacatttctctctcgaaTCTAGAtactttactactgcacAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAggaccattgcgacgtaAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAcctagccactagatggAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAatggagggagtctactAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAtagtgtaaacgccacgAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAccaacgcgtgaatcgcAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAatcgtatccatgggtaAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAggtcacgtgtctatatAGATCGGAAGAGCGTCGTGTAGGGAAAGAG). Gel and bead purify the products and perform HiFi reaction to insert the barcoded gene into pH2rU3_ForInd_mCherry_CMV_ZsGT2APurR vector that has been digested with MluI and XbaI enzymes. Transform the HiFi reaction into stable cells (e.g. NEB 10b cells). Screen colonies for correct barcodes and pool all 8 barcoded plasmids together before performing lentivirus rescues.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pH2rU3_ForInd_mCherry_CMV_ZsGT2APurR was a gift from Jesse Bloom (Addgene plasmid # 204579 ; http://n2t.net/addgene:204579 ; RRID:Addgene_204579) -
For your References section:
A pseudovirus system enables deep mutational scanning of the full SARS-CoV-2 spike. Dadonaite B, Crawford KHD, Radford CE, Farrell AG, Yu TC, Hannon WW, Zhou P, Andrabi R, Burton DR, Liu L, Ho DD, Chu HY, Neher RA, Bloom JD. Cell. 2023 Mar 16;186(6):1263-1278.e20. doi: 10.1016/j.cell.2023.02.001. Epub 2023 Feb 13. 10.1016/j.cell.2023.02.001 PubMed 36868218