pH2rU3_ForInd_mCherry_CMV_ZsGT2APurR
(Plasmid #204579)

• Purpose: lentivirus backbone cloning vector and template for barcoded non-neutralizable standard production
• Depositing Lab: Jesse Bloom
• Publication: Dadonaite et al Cell. 2023 Mar 16;186(6):1263-1278.e20. doi: 10.1016/j.cell.2023.02.001. Epub 2023 Feb 13.

Backbone

• Vector backbone: pH2rU3
• Total vector size (bp): 9340
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry
• Insert Size (bp): 711
• Promoter: TRE3G

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: cagccgagccacatcgc
• 3′ sequencing primer: gttatgtaacgcggaactccactagg

Resource Information

• Supplemental Documents:
  • 3137_pH2rU3_ForInd_mCherry_CMV_ZsGT2APurR.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For cloning lentiviral entry proteins into this plasmid digest it with MluI and AscI enzymes and use HiFi reaction to clone in the viral protein.

For making non-neutralizible standard you need to first barcode mCherry gene. To do so amplify mChery from the backbone using forward (CAGCCGAGCCACATCGCTC)
and reverse (CGGAAGAGCGTCGTGTAGGGAAAG) primers and gel purify the product. Use the product to barcode the mCherry gene using forward primer (gcacgcgCAGCCGAGCCACATCGCTCA) and one if reverse the primers containing unique barcodes. (gcggaactccactaggaacatttctctctcgaaTCTAGAtactttactactgcacAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAggaccattgcgacgtaAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAcctagccactagatggAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAatggagggagtctactAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAtagtgtaaacgccacgAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAccaacgcgtgaatcgcAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAatcgtatccatgggtaAGATCGGAAGAGCGTCGTGTAGGGAAAGAG; gcggaactccactaggaacatttctctctcgaaTCTAGAggtcacgtgtctatatAGATCGGAAGAGCGTCGTGTAGGGAAAGAG). Gel and bead purify the products and perform HiFi reaction to insert the barcoded gene into pH2rU3_ForInd_mCherry_CMV_ZsGT2APurR vector that has been digested with MluI and XbaI enzymes. Transform the HiFi reaction into stable cells (e.g. NEB 10b cells). Screen colonies for correct barcodes and pool all 8 barcoded plasmids together before performing lentivirus rescues.