Skip to main content

pHAGE2_EF1a_TetOn_IRES_mCherry
(Plasmid #204155)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204155 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHAGE2
  • Total vector size (bp) 9026
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tet-On 3G
  • Insert Size (bp)
    745
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer agcctcagacagtggttcaaagt
  • 3′ sequencing primer ccttattccaagcggcttcgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE2_EF1a_TetOn_IRES_mCherry was a gift from Jesse Bloom (Addgene plasmid # 204155 ; http://n2t.net/addgene:204155 ; RRID:Addgene_204155)
  • For your References section:

    A pseudovirus system enables deep mutational scanning of the full SARS-CoV-2 spike. Dadonaite B, Crawford KHD, Radford CE, Farrell AG, Yu TC, Hannon WW, Zhou P, Andrabi R, Burton DR, Liu L, Ho DD, Chu HY, Neher RA, Bloom JD. Cell. 2023 Mar 16;186(6):1263-1278.e20. doi: 10.1016/j.cell.2023.02.001. Epub 2023 Feb 13. 10.1016/j.cell.2023.02.001 PubMed 36868218