pUDP293
(Plasmid #204228)

• Purpose: Episomal yeast plasmid expressing the Ercas12a and ErCas12a gRNA
• Depositing Lab: Jean-Marc Daran
• Publication: Expanding the genome editing toolbox of Saccharomyces cerevisiae with ErCas12a (unpublished)

Backbone

• Vector backbone: pMEL12
• Modifications to backbone: The vector was constructed by Gibson assembly using the the following part : - The yeast marker cassette A-pAgTEF1-hphNT1R-tAgTEF1-B was amplified from plasmid pMEL12 . - The yeast origin F-panARSopt-C was amplified from pUD530 . - The E. coli origin and marker, I-ori blaR-A, was amplified from pUD532. - The crRNA insertion expression cassette (short DR and RNApolII design) was amplified from pUD1190 -. The Ercas12a expression cassette was amplified from pUDE1093
• Vector type: Synthetic Biology
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Eubacterium rectale cas12a (Ercas12a)
• Alt name: MAD7
• Species: Synthetic; Eubacterium rectale
• Insert Size (bp): 3789
• Mutation: codon optimized for S. cerevisiae
• GenBank ID: MH347339.1
• Promoter: Saccharomyces cerevisiae PGK1
• Tag / Fusion Protein:
  • NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGAACAACGGTACTAACAACTTCC
• 3′ sequencing primer: TTACACCTTCCTCTTCTTCTTGG

Gene/Insert 2

• Gene/Insert name: BsaI_GFP drop-out_BsaI
• Species: Synthetic
• Insert Size (bp): 1012
• Promoter: Saccharomyces cerevisiae TDH3

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTGATGAGTCCGTGAGGACGAAACG
• 3′ sequencing primer: CTTCAGAATCGTTATCCTGGCGG

Resource Information

• Supplemental Documents:
  • pUDP293.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The construction of the episomal plasmid enabling the expression of Ercas12a together with the crRNA was performed by Gibson assembly of five fragments flanked with compatible SHR sequences (Kuijpers et al., 2013). The yeast marker cassette A-pAgTEF1-hphNT1R-tAgTEF1-B was amplified from plasmid pMEL12 (Mans et al., 2015) . The yeast origin F-panARSopt-C was amplified from pUD530 (Gorter de Vries et al., 2017) . The E. coli origin and marker, I-ori blaR-A, was amplified from pUD532 (Gorter de Vries et al., 2017) . The crRNA insertion expression cassette (short DR and RNApolII design) was amplified from pUD1190 . The Ercas12a expression cassette was amplified from pUDE1093 . Gibson assembly of these five fragments resulted in pUDP293.

Kuijpers NG, Solis-Escalante D, Bosman L, van den Broek M, Pronk JT, Daran JM & Daran-Lapujade P (2013) A versatile, efficient strategy for assembly of multi-fragment expression vectors in Saccharomyces cerevisiae using 60 bp synthetic recombination sequences. Microb Cell Fact 12: 47.
Mans R, van Rossum HM, Wijsman M, Backx A, Kuijpers NG, van den Broek M, Daran-Lapujade P, Pronk JT, van Maris AJ & Daran JM (2015) CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. FEMS Yeast Res 15.
Gorter de Vries AR, de Groot PA, van den Broek M & Daran J-MG (2017) CRISPR-Cas9 mediated gene deletions in lager yeast Saccharomyces pastorianus. Microbial Cell Factories 16: 222.