pUDP293
(Plasmid
#204228)
-
PurposeEpisomal yeast plasmid expressing the Ercas12a and ErCas12a gRNA
-
Depositing Lab
-
Depositing OrganizationDelft University of Technology
Located in Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204228 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMEL12
-
Modifications to backboneThe vector was constructed by Gibson assembly using the the following part : - The yeast marker cassette A-pAgTEF1-hphNT1R-tAgTEF1-B was amplified from plasmid pMEL12 . - The yeast origin F-panARSopt-C was amplified from pUD530 . - The E. coli origin and marker, I-ori blaR-A, was amplified from pUD532. - The crRNA insertion expression cassette (short DR and RNApolII design) was amplified from pUD1190 -. The Ercas12a expression cassette was amplified from pUDE1093
-
Vector typeSynthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameEubacterium rectale cas12a (Ercas12a)
-
Alt nameMAD7
-
SpeciesSynthetic; Eubacterium rectale
-
Insert Size (bp)3789
-
Mutationcodon optimized for S. cerevisiae
-
GenBank IDMH347339.1
- Promoter Saccharomyces cerevisiae PGK1
-
Tag
/ Fusion Protein
- NLS (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGAACAACGGTACTAACAACTTCC
- 3′ sequencing primer TTACACCTTCCTCTTCTTCTTGG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameBsaI_GFP drop-out_BsaI
-
SpeciesSynthetic
-
Insert Size (bp)1012
- Promoter Saccharomyces cerevisiae TDH3
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGATGAGTCCGTGAGGACGAAACG
- 3′ sequencing primer CTTCAGAATCGTTATCCTGGCGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The construction of the episomal plasmid enabling the expression of Ercas12a together with the crRNA was performed by Gibson assembly of five fragments flanked with compatible SHR sequences (Kuijpers et al., 2013). The yeast marker cassette A-pAgTEF1-hphNT1R-tAgTEF1-B was amplified from plasmid pMEL12 (Mans et al., 2015) . The yeast origin F-panARSopt-C was amplified from pUD530 (Gorter de Vries et al., 2017) . The E. coli origin and marker, I-ori blaR-A, was amplified from pUD532 (Gorter de Vries et al., 2017) . The crRNA insertion expression cassette (short DR and RNApolII design) was amplified from pUD1190 . The Ercas12a expression cassette was amplified from pUDE1093 . Gibson assembly of these five fragments resulted in pUDP293.
Kuijpers NG, Solis-Escalante D, Bosman L, van den Broek M, Pronk JT, Daran JM & Daran-Lapujade P (2013) A versatile, efficient strategy for assembly of multi-fragment expression vectors in Saccharomyces cerevisiae using 60 bp synthetic recombination sequences. Microb Cell Fact 12: 47.
Mans R, van Rossum HM, Wijsman M, Backx A, Kuijpers NG, van den Broek M, Daran-Lapujade P, Pronk JT, van Maris AJ & Daran JM (2015) CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. FEMS Yeast Res 15.
Gorter de Vries AR, de Groot PA, van den Broek M & Daran J-MG (2017) CRISPR-Cas9 mediated gene deletions in lager yeast Saccharomyces pastorianus. Microbial Cell Factories 16: 222.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUDP293 was a gift from Jean-Marc Daran (Addgene plasmid # 204228 ; http://n2t.net/addgene:204228 ; RRID:Addgene_204228) -
For your References section:
Expanding the genome editing toolbox of Saccharomyces cerevisiae with the endonuclease ErCas12a. Bennis NX, Anderson JP, Kok SMC, Daran JG. FEMS Yeast Res. 2023 Jan 4;23:foad043. doi: 10.1093/femsyr/foad043. 10.1093/femsyr/foad043 PubMed 37791490