Skip to main content

pUDP293
(Plasmid #204228)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204228 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pMEL12
  • Modifications to backbone
    The vector was constructed by Gibson assembly using the the following part : - The yeast marker cassette A-pAgTEF1-hphNT1R-tAgTEF1-B was amplified from plasmid pMEL12 . - The yeast origin F-panARSopt-C was amplified from pUD530 . - The E. coli origin and marker, I-ori blaR-A, was amplified from pUD532. - The crRNA insertion expression cassette (short DR and RNApolII design) was amplified from pUD1190 -. The Ercas12a expression cassette was amplified from pUDE1093
  • Vector type
    Synthetic Biology
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Eubacterium rectale cas12a (Ercas12a)
  • Alt name
    MAD7
  • Species
    Synthetic; Eubacterium rectale
  • Insert Size (bp)
    3789
  • Mutation
    codon optimized for S. cerevisiae
  • GenBank ID
    MH347339.1
  • Promoter Saccharomyces cerevisiae PGK1
  • Tag / Fusion Protein
    • NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGAACAACGGTACTAACAACTTCC
  • 3′ sequencing primer TTACACCTTCCTCTTCTTCTTGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    BsaI_GFP drop-out_BsaI
  • Species
    Synthetic
  • Insert Size (bp)
    1012
  • Promoter Saccharomyces cerevisiae TDH3

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTGATGAGTCCGTGAGGACGAAACG
  • 3′ sequencing primer CTTCAGAATCGTTATCCTGGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The construction of the episomal plasmid enabling the expression of Ercas12a together with the crRNA was performed by Gibson assembly of five fragments flanked with compatible SHR sequences (Kuijpers et al., 2013). The yeast marker cassette A-pAgTEF1-hphNT1R-tAgTEF1-B was amplified from plasmid pMEL12 (Mans et al., 2015) . The yeast origin F-panARSopt-C was amplified from pUD530 (Gorter de Vries et al., 2017) . The E. coli origin and marker, I-ori blaR-A, was amplified from pUD532 (Gorter de Vries et al., 2017) . The crRNA insertion expression cassette (short DR and RNApolII design) was amplified from pUD1190 . The Ercas12a expression cassette was amplified from pUDE1093 . Gibson assembly of these five fragments resulted in pUDP293.

Kuijpers NG, Solis-Escalante D, Bosman L, van den Broek M, Pronk JT, Daran JM & Daran-Lapujade P (2013) A versatile, efficient strategy for assembly of multi-fragment expression vectors in Saccharomyces cerevisiae using 60 bp synthetic recombination sequences. Microb Cell Fact 12: 47.
Mans R, van Rossum HM, Wijsman M, Backx A, Kuijpers NG, van den Broek M, Daran-Lapujade P, Pronk JT, van Maris AJ & Daran JM (2015) CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. FEMS Yeast Res 15.
Gorter de Vries AR, de Groot PA, van den Broek M & Daran J-MG (2017) CRISPR-Cas9 mediated gene deletions in lager yeast Saccharomyces pastorianus. Microbial Cell Factories 16: 222.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUDP293 was a gift from Jean-Marc Daran (Addgene plasmid # 204228 ; http://n2t.net/addgene:204228 ; RRID:Addgene_204228)
  • For your References section:

    Expanding the genome editing toolbox of Saccharomyces cerevisiae with the endonuclease ErCas12a. Bennis NX, Anderson JP, Kok SMC, Daran JG. FEMS Yeast Res. 2023 Jan 4;23:foad043. doi: 10.1093/femsyr/foad043. 10.1093/femsyr/foad043 PubMed 37791490