-
PurposeGEMS sensor system (pCMV-EGFP-m6Areporter-DHFR, Ef1a-APO1-YTH, hPGK-DsRed) (pFM577)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204765 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneiDuet101a
- Backbone size w/o insert (bp) 11400
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP-m6Alinker-DHFR
-
SpeciesSynthetic
-
Insert Size (bp)1275
-
Mutationmutated all RACs in EGFP to RGC/RCC
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEMS-II was a gift from Kate Meyer (Addgene plasmid # 204765 ; http://n2t.net/addgene:204765 ; RRID:Addgene_204765) -
For your References section:
Programmable protein expression using a genetically encoded m(6)A sensor. Marayati BF, Thompson MG, Holley CL, Horner SM, Meyer KD. Nat Biotechnol. 2024 Jan 2. doi: 10.1038/s41587-023-01978-3. 10.1038/s41587-023-01978-3 PubMed 38168988