Skip to main content

pU6-PspCas13b-GEMSgRNA2
(Plasmid #204768)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204768 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pU6-PspCas13b-gRNA
  • Backbone size w/o insert (bp) 2940
  • Total vector size (bp) 2970
  • Modifications to backbone
    add gRNA sequence downstream of U6 promoter
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    guide RNA targeting GEMS m6A sensor mRNA
  • gRNA/shRNA sequence
    CCGCCGCATCTAACACATTGATCCTAGCAG
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer caggaaacagctatgac
  • 3′ sequencing primer tgtaaaacgacggccagt
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-PspCas13b-GEMSgRNA2 was a gift from Kate Meyer (Addgene plasmid # 204768 ; http://n2t.net/addgene:204768 ; RRID:Addgene_204768)
  • For your References section:

    Programmable protein expression using a genetically encoded m(6)A sensor. Marayati BF, Thompson MG, Holley CL, Horner SM, Meyer KD. Nat Biotechnol. 2024 Jan 2. doi: 10.1038/s41587-023-01978-3. 10.1038/s41587-023-01978-3 PubMed 38168988