Skip to main content

pcDNA-tdMCP-24xGCN4
(Plasmid #205157)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205157 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA
  • Total vector size (bp) 7850
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    tdMCP-24xGCN4
  • Species
    Synthetic
  • Insert Size (bp)
    2481
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    tdMCP is amplified from Addene plasmid #64541 and the suntag arrays is amplified from Addene plasmid #74928

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA-tdMCP-24xGCN4 was a gift from Weirui Ma (Addgene plasmid # 205157 ; http://n2t.net/addgene:205157 ; RRID:Addgene_205157)
  • For your References section:

    Enhanced single RNA imaging reveals dynamic gene expression in live animals. Hu Y, Xu J, Gao E, Fan X, Wei J, Ye B, Xu S, Ma W. Elife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. 10.7554/eLife.82178 PubMed 36867026