Skip to main content
Addgene

pAAV-Syn-SomArchon-mTagBFP2-p2A-CoChR-Kv2.1
(Plasmid #206006)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206006 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV2-Syn
  • Backbone size w/o insert (bp) 6337
  • Total vector size (bp) 7517
  • Modifications to backbone
    N/A
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SomArchon-mTagBFP2-P2A-CoChR-Kv2.1
  • Alt name
    Soma-Optopatch-mTagBFP2
  • Species
    Synthetic
  • Insert Size (bp)
    1182
  • GenBank ID
    OR336299
  • Promoter hSyn
  • Tag / Fusion Protein
    • mTagBFP2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ggaaagaatcaaggaggcca
  • 3′ sequencing primer gtatccacatagcgtaaaaggagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Syn-SomArchon-mTagBFP2-p2A-CoChR-Kv2.1 was a gift from Xue Han (Addgene plasmid # 206006 ; http://n2t.net/addgene:206006 ; RRID:Addgene_206006)
  • For your References section:

    Theta and gamma rhythmic coding through two spike output modes in the hippocampus during spatial navigation. Lowet E, Sheehan DJ, Chialva U, De Oliveira Pena R, Mount RA, Xiao S, Zhou SL, Tseng HA, Gritton H, Shroff S, Kondabolu K, Cheung C, Wang Y, Piatkevich KD, Boyden ES, Mertz J, Hasselmo ME, Rotstein HG, Han X. Cell Rep. 2023 Aug 29;42(8):112906. doi: 10.1016/j.celrep.2023.112906. Epub 2023 Aug 3. 10.1016/j.celrep.2023.112906 PubMed 37540599