pAAV-Syn-SomArchon-mTagBFP2-p2A-CoChR-Kv2.1
(Plasmid
#206006)
-
PurposeExpression of SomArchon-mTagBFP2 and CoChR under Syn promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206006 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV2-Syn
- Backbone size w/o insert (bp) 6337
- Total vector size (bp) 7517
-
Modifications to backboneN/A
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSomArchon-mTagBFP2-P2A-CoChR-Kv2.1
-
Alt nameSoma-Optopatch-mTagBFP2
-
SpeciesSynthetic
-
Insert Size (bp)1182
-
GenBank IDOR336299
- Promoter hSyn
-
Tag
/ Fusion Protein
- mTagBFP2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer ggaaagaatcaaggaggcca
- 3′ sequencing primer gtatccacatagcgtaaaaggagc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Syn-SomArchon-mTagBFP2-p2A-CoChR-Kv2.1 was a gift from Xue Han (Addgene plasmid # 206006 ; http://n2t.net/addgene:206006 ; RRID:Addgene_206006) -
For your References section:
Theta and gamma rhythmic coding through two spike output modes in the hippocampus during spatial navigation. Lowet E, Sheehan DJ, Chialva U, De Oliveira Pena R, Mount RA, Xiao S, Zhou SL, Tseng HA, Gritton H, Shroff S, Kondabolu K, Cheung C, Wang Y, Piatkevich KD, Boyden ES, Mertz J, Hasselmo ME, Rotstein HG, Han X. Cell Rep. 2023 Aug 29;42(8):112906. doi: 10.1016/j.celrep.2023.112906. Epub 2023 Aug 3. 10.1016/j.celrep.2023.112906 PubMed 37540599