cacna2d1 R241A D491A HA pcDNA3
(Plasmid
#206109)
-
Purposeexpression of rat alpha2delta-1 calcium channel auxillary subunit with a single HA tag inserted after aa549 and with R421A and D491A mutations that both disrupt Gabapentin binding
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206109 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen Life Technologies
- Backbone size w/o insert (bp) 5446
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecacna2d1
-
Alt namealpha2delta-1
-
SpeciesR. norvegicus (rat)
-
MutationR241A D491A
-
Entrez GeneCacna2d1 (a.k.a. CCHLA2, Cacna2, DHSCCA)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CTGGCTAACTAGAGAACC
- 3′ sequencing primer GCATTTAGGTGACACTATAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKevin Campbell
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cacna2d1 R241A D491A HA pcDNA3 was a gift from Annette Dolphin (Addgene plasmid # 206109 ; http://n2t.net/addgene:206109 ; RRID:Addgene_206109)