Skip to main content

Cav2.1 EA2, R57A, R59A pMT2
(Plasmid #206122)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206122 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMT2
  • Backbone manufacturer
    Genetics Institute Inc
  • Backbone size w/o insert (bp) 5163
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cacna1a
  • Alt name
    Cav2.1 alpha1A/EA2
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3792
  • Mutation
    Cav2.1-P1217fs, R57A, R59A
  • Entrez Gene
    Cacna1a (a.k.a. BccA1, Cav2.1, rbA-1)
  • Promoter Ad MLP/TPL/SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer AGCTTGAGGTGTGGCAGGCTT
  • 3′ sequencing primer GGTCGAACCATGATGGCAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Terry P. Snutch

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cav2.1 EA2, R57A, R59A pMT2 was a gift from Annette Dolphin (Addgene plasmid # 206122 ; http://n2t.net/addgene:206122 ; RRID:Addgene_206122)
  • For your References section:

    A CaV2.1 N-terminal fragment relieves the dominant-negative inhibition by an Episodic ataxia 2 mutant. Dahimene S, Page KM, Nieto-Rostro M, Pratt WS, D'Arco M, Dolphin AC. Neurobiol Dis. 2016 Sep;93:243-56. doi: 10.1016/j.nbd.2016.05.020. Epub 2016 May 31. 10.1016/j.nbd.2016.05.020 PubMed 27260834