CMV SNAP-Synapsin
(Plasmid
#206152)
-
PurposeCMV SNAP-Synapsin
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206152 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C3 Synapsin
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 6500
-
Modifications to backbonereplaced EGFP with SNAPf
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSynapsin
-
Insert Size (bp)570
- Promoter CMV
-
Tag
/ Fusion Protein
- SNAPf (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site XnoI (filled-in) / BamHi (filled-in); XhoI restored (unknown if destroyed)
- 5′ sequencing primer 5’ - GAAATCCCGTGCCCATTCTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypSNAPf Vector from NEB
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV SNAP-Synapsin was a gift from Erika Holzbaur (Addgene plasmid # 206152 ; http://n2t.net/addgene:206152 ; RRID:Addgene_206152) -
For your References section:
RAB3 phosphorylation by pathogenic LRRK2 impairs trafficking of synaptic vesicle precursors. Dou D, Aiken J, Holzbaur ELF. J Cell Biol. 2024 Jun 3;223(6):e202307092. doi: 10.1083/jcb.202307092. Epub 2024 Mar 21. 10.1083/jcb.202307092 PubMed 38512027