-
PurposeAAV packaging vector containing AAV2 rep and KP1 cap and partial AAV2 p5 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206504 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV2 rep, partial p5 in generic backbone
- Backbone size w/o insert (bp) 5116
- Total vector size (bp) 7333
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable ;
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKP1 capsid
-
Speciesadeno-associated virus
-
Insert Size (bp)2214
-
GenBank IDMN428626.1
- Promoter p5
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Swa I (not destroyed)
- 3′ cloning site Age I (not destroyed)
- 5′ sequencing primer TGGATGACTGCATCTTTGAA
- 3′ sequencing primer GCAGGTTTAAACGAATTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-KP1 was a gift from Mark Kay (Addgene plasmid # 206504 ; http://n2t.net/addgene:206504 ; RRID:Addgene_206504) -
For your References section:
Using a barcoded AAV capsid library to select for clinically relevant gene therapy vectors. Pekrun K, De Alencastro G, Luo QJ, Liu J, Kim Y, Nygaard S, Galivo F, Zhang F, Song R, Tiffany MR, Xu J, Hebrok M, Grompe M, Kay MA. JCI Insight. 2019 Nov 14;4(22). pii: 131610. doi: 10.1172/jci.insight.131610. 10.1172/jci.insight.131610 PubMed 31723052