Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

AAV-AM
(Plasmid #206513)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 206513 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV2 rep, partial p5 in generic backbone
  • Backbone size w/o insert (bp) 5119
  • Total vector size (bp) 7333
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable ;
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AM capsid
  • Species
    adeno-associated virus
  • Insert Size (bp)
    2214
  • Promoter p5

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Swa I (not destroyed)
  • 3′ cloning site Age I (not destroyed)
  • 5′ sequencing primer TGGATGACTGCATCTTTGAA
  • 3′ sequencing primer GCAGGTTTAAACGAATTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-AM was a gift from Mark Kay (Addgene plasmid # 206513 ; http://n2t.net/addgene:206513 ; RRID:Addgene_206513)
  • For your References section:

    The AAV capsid can influence the epigenetic marking of rAAV delivered episomal genomes in a species dependent manner. Gonzalez-Sandoval A, Pekrun K, Tsuji S, Zhang F, Hung KL, Chang HY, Kay MA. Nat Commun. 2023 Apr 28;14(1):2448. doi: 10.1038/s41467-023-38106-3. 10.1038/s41467-023-38106-3 PubMed 37117181