pBabePuro-FLAG-KrasnatG12D
(Plasmid
#206865)
-
PurposeTo stably express mouse Kras encoded by native mouse codons and with a G12D mutation with an N-terminal FLAG tag in cells resistant to Neo.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206865 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBabePuro
- Backbone size w/o insert (bp) 5086
- Total vector size (bp) 5678
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKras
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)621
-
Mutationchanged Glycine 12 to Aspartic Acid
-
GenBank IDNM_001403240.1
-
Entrez GeneKras (a.k.a. K-Ras, K-Ras 2, K-ras, Ki-ras, Kras-2, Kras2, c-K-ras, c-Ki-ras, p21B, ras)
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ctttatccagccctcac
- 3′ sequencing primer CCCTAACTGACACACATTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBabePuro-FLAG-KrasnatG12D was a gift from Christopher Counter (Addgene plasmid # 206865) -
For your References section:
Genetically manipulating endogenous Kras levels and oncogenic mutations in vivo influences tissue patterning of murine tumorigenesis. Le Roux O, Pershing NLK, Kaltenbrun E, Newman NJ, Everitt JI, Baldelli E, Pierobon M, Petricoin EF, Counter CM. Elife. 2022 Sep 7;11:e75715. doi: 10.7554/eLife.75715. 10.7554/eLife.75715 PubMed 36069770