A3Bmax
(Plasmid
#207167)
-
PurposeExpress full-length human A3B in a BE4max-based base editor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207167 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneBE4max
- Backbone size w/o insert (bp) 8007
- Total vector size (bp) 10000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B
-
Alt nameAPOBEC3
-
Alt nameA3B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2048
-
GenBank IDNM_004900
-
Entrez GeneAPOBEC3B (a.k.a. A3B, APOBEC1L, ARCD3, ARP4, DJ742C19.2, PHRBNL, bK150C2.2)
- Promoter CMV
-
Tags
/ Fusion Proteins
- NLS, 6x His (C terminal on insert)
- NLS (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer tagaaggcacagtcgagg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Additional important insert: Cas9n-UGI-UGI-NLS
Please note: Plasmid contains an E198K mutation in Cas9. This mutation is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
A3Bmax was a gift from Reuben Harris (Addgene plasmid # 207167 ; http://n2t.net/addgene:207167 ; RRID:Addgene_207167) -
For your References section:
APOBEC Reporter Systems for Evaluating diNucleotide Editing Levels. Rieffer AE, Chen Y, Salamango DJ, Moraes SN, Harris RS. CRISPR J. 2023 Oct;6(5):430-446. doi: 10.1089/crispr.2023.0027. Epub 2023 Sep 6. 10.1089/crispr.2023.0027 PubMed 37672599