Skip to main content
Addgene
Open Menu

A3Bmax
(Plasmid #207167)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207167 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 207167-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 207167-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    BE4max
  • Backbone size w/o insert (bp) 8007
  • Total vector size (bp) 10000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Apolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B
  • Alt name
    APOBEC3
  • Alt name
    A3B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2048
  • GenBank ID
    NM_004900
  • Entrez Gene
    APOBEC3B (a.k.a. A3B, APOBEC1L, ARCD3, ARP4, DJ742C19.2, PHRBNL, bK150C2.2)
  • Promoter CMV
  • Tags / Fusion Proteins
    • NLS, 6x His (C terminal on insert)
    • NLS (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer tagaaggcacagtcgagg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Additional important insert: Cas9n-UGI-UGI-NLS

Please note: Plasmid contains an E198K mutation in Cas9. This mutation is not known to affect plasmid function.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    A3Bmax was a gift from Reuben Harris (Addgene plasmid # 207167 ; http://n2t.net/addgene:207167 ; RRID:Addgene_207167)

  • For your References section:

    APOBEC Reporter Systems for Evaluating diNucleotide Editing Levels. Rieffer AE, Chen Y, Salamango DJ, Moraes SN, Harris RS. CRISPR J. 2023 Oct;6(5):430-446. doi: 10.1089/crispr.2023.0027. Epub 2023 Sep 6. 10.1089/crispr.2023.0027 PubMed 37672599
Related items:
Commonly requested with: