ykgMO-IGS-LuxCDABE
(Plasmid
#207232)
-
PurposeCalprotectin sensing promoter with luciferase reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207232 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJBL5034
-
Backbone manufacturerp15A ori plasmid
- Backbone size w/o insert (bp) 2269
- Total vector size (bp) 8212
-
Vector typeBacterial Expression, Luciferase, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameykgMO-IGS
-
Alt nameL36-IGS
-
SpeciesE. coli
-
Insert Size (bp)364
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAACGGCAATAAACTGTTCACTTCAGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ykgMO-IGS-LuxCDABE was a gift from Arthur Prindle (Addgene plasmid # 207232 ; http://n2t.net/addgene:207232 ; RRID:Addgene_207232) -
For your References section:
Engineered calprotectin-sensing probiotics for IBD surveillance in humans. Xia JY, Hepler C, Tran P, Waldeck NJ, Bass J, Prindle A. Proc Natl Acad Sci U S A. 2023 Aug 8;120(32):e2221121120. doi: 10.1073/pnas.2221121120. Epub 2023 Jul 31. 10.1073/pnas.2221121120 PubMed 37523538