Skip to main content
Addgene

pET-21(+)Tm9D8* TrpB
(Plasmid #207517)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207517 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-21(+)
  • Backbone size w/o insert (bp) 5378
  • Total vector size (bp) 6566
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tryptophan synthase β-subunit
  • Alt name
    Tm9D8* TrpB
  • Species
    Thermotoga maritima
  • Insert Size (bp)
    1188
  • Promoter T7

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-21(+)Tm9D8* TrpB was a gift from Thomas Huber (Addgene plasmid # 207517 ; http://n2t.net/addgene:207517 ; RRID:Addgene_207517)
  • For your References section:

    Genetic Encoding of 7-Aza-l-tryptophan: Isoelectronic Substitution of a Single CH-Group in a Protein for a Nitrogen Atom for Site-Selective Isotope Labeling. Abdelkader EH, Qianzhu H, Huber T, Otting G. ACS Sens. 2023 Oct 27. doi: 10.1021/acssensors.3c01904. 10.1021/acssensors.3c01904 PubMed 37890165