Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

qTAG-N-Blast-ultraID-LMNB1
(Plasmid #207775)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 207775 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC19
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2686
  • Vector type
    Mammalian Expression, CRISPR ; Donor Template
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LMNB1 Homology Arms flanking a Blast-ultraID Cassette
  • Alt name
    LMNB1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3007
  • Entrez Gene
    LMNB1 (a.k.a. ADLD, LMN, LMN2, LMNB, MCPH26)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CTGCAAGGCGATTAAGTTGGGTAAC
  • 3′ sequencing primer GGCTCGTATGTTGTGTGGAATTGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 https://www.addgene.org/207770 .

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    qTAG-N-Blast-ultraID-LMNB1 was a gift from Laurence Pelletier (Addgene plasmid # 207775 ; http://n2t.net/addgene:207775 ; RRID:Addgene_207775)
  • For your References section:

    qTAG: An adaptable CRISPR-based endogenous tagging protocol using optimized repair cassettes. Philip R, Sharma A, Matellan L, Erpf AC, Hsu W, Tkach JM, Wyatt HDM, Pelletier L. bioRxiv 10.1101/2023.11.01.565029