-
Purposetelomere specific nuclease to create double-strand breaks at telomeres
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207832 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLenti-CMV-TRE3G
-
Backbone manufacturertakara
- Total vector size (bp) 11843
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTRF1
-
SpeciesH. sapiens (human)
-
Entrez GeneTERF1 (a.k.a. PIN2, TRBF1, TRF, TRF1, hTRF1-AS, t-TRF1)
- Promoter TRE3G
-
Tags
/ Fusion Proteins
- Flag, DD, ER, mCherry (N terminal on insert)
- FokI (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GTTTGTACAAAAAAGCAGGC
- 3′ sequencing primer CTTTCACAAATTTTGTAATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti CMV TRE3G Puro FLAG-DD-ER-mCherry-TRF1-FokI WT was a gift from Roger Greenberg (Addgene plasmid # 207832 ; http://n2t.net/addgene:207832 ; RRID:Addgene_207832) -
For your References section:
Break-induced telomere synthesis underlies alternative telomere maintenance. Dilley RL, Verma P, Cho NW, Winters HD, Wondisford AR, Greenberg RA. Nature. 2016 Nov 3;539(7627):54-58. doi: 10.1038/nature20099. Epub 2016 Oct 19. 10.1038/nature20099 PubMed 27760120