Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

miR-124-5 promoter GFP
(Plasmid #20792)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 20792 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBSII SK+ modified to introduce GFP and more cloning sites
  • Backbone manufacturer
    Bartel Lab
  • Vector type
    zebrafish expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mir-124
  • Alt name
    miR124
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    5600
  • Entrez Gene
    mir124-5 (a.k.a. dre-mir-124-5)
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (destroyed during cloning)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer TGCTTTGAGGCACGGTTATGGTCCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5′-RACE (GenRacer kit, Invitrogen) identified a transcriptional start of the mir-124-5 primary transcript, which is located 1.1 kb from the mir-124-5 hairpin. A 5.6-kb fragment upstream of the mir-124-5 transcriptional start was amplified from genomic DNA using primers 1 and 2 (5'-TGCTTTGAGGCACGGTTATGGTCCC-3' and 5'-CTCGGGCAGCGGCTTTTTGGTCCTG-3'). The promoter fragment was fused to a GFP reporter gene. The miRNA promoter fusion was flanked by I-SceI meganuclease recognition sites to increase the efficiency of transgenensis.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    miR-124-5 promoter GFP was a gift from David Bartel (Addgene plasmid # 20792 ; http://n2t.net/addgene:20792 ; RRID:Addgene_20792)
  • For your References section:

    Coherent but overlapping expression of microRNAs and their targets during vertebrate development. Shkumatava A, Stark A, Sive H, Bartel DP. Genes Dev. 2009 Feb 15. 23(4):466-81. 10.1101/gad.1745709 PubMed 19240133