Skip to main content

pGL3-NurRE3
(Plasmid #208253)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208253 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL3-promoter
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5010
  • Total vector size (bp) 5086
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    3X Nur response element LUC
  • Alt name
    3X-NurRE-LUC
  • Species
    H. sapiens (human)
  • Promoter SV40 early promoter
  • Tag / Fusion Protein
    • No

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The plasmids were cloned in the Kojetin lab.

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-NurRE3 was a gift from Douglas Kojetin (Addgene plasmid # 208253 ; http://n2t.net/addgene:208253 ; RRID:Addgene_208253)
  • For your References section:

    Assessment of NR4A Ligands That Directly Bind and Modulate the Orphan Nuclear Receptor Nurr1. Munoz-Tello P, Lin H, Khan P, de Vera IMS, Kamenecka TM, Kojetin DJ. J Med Chem. 2020 Dec 24;63(24):15639-15654. doi: 10.1021/acs.jmedchem.0c00894. Epub 2020 Dec 8. 10.1021/acs.jmedchem.0c00894 PubMed 33289551