Skip to main content

pAAV-CAG-mCherry-Tandem-PSAM4-GlyR
(Plasmid #208361)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208361 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 7242
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry-TANDEM-PSAM4-GlyR
  • Alt name
    mCherry-P2A-T2A-PSAM4-GlyR
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2142
  • Promoter CAG
  • Tag / Fusion Protein
    • mCherry

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer GCCTCTGCTAACCATGTTCATGCCTTCTTC
  • 3′ sequencing primer GGCTGATCAGCGGGTTTAAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Original construct for PSAM4-GlyR was a gift from Scott Sternson (Addgene plasmid #119739) Magnus et al Science. 2019. All other parts were generated using gene fragment synthesis.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The tandem linker sequence (Furin-GSG-P2A-GSG-T2A) was first used by Lui et al 2017, PMID: 28526819

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-mCherry-Tandem-PSAM4-GlyR was a gift from David Bennett (Addgene plasmid # 208361 ; http://n2t.net/addgene:208361 ; RRID:Addgene_208361)
  • For your References section:

    A humanized chemogenetic system inhibits murine pain-related behavior and hyperactivity in human sensory neurons. Perez-Sanchez J, Middleton SJ, Pattison LA, Hilton H, Ali Awadelkareem M, Zuberi SR, Renke MB, Hu H, Yang X, Clark AJ, St John Smith E, Bennett DL. Sci Transl Med. 2023 Oct 4;15(716):eadh3839. doi: 10.1126/scitranslmed.adh3839. Epub 2023 Oct 4. 10.1126/scitranslmed.adh3839 PubMed 37792955