Skip to main content

MD-2
(Plasmid #20864)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 20864 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAcGP67A
  • Backbone manufacturer
    BD biosciences
  • Backbone size w/o insert (bp) 9761
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Myeloid differentiation factor 2
  • Alt name
    MD-2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    861
  • Mutation
    contains amino acids 19–160
  • GenBank ID
    NP_056179.3
  • Entrez Gene
    LY96 (a.k.a. ESOP-1, MD-2, MD2, ly-96)
  • Tag / Fusion Protein
    • protein A tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ggcttcaataaggaacacacaagcaag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MD-2 was a gift from Jie-Oh Lee (Addgene plasmid # 20864 ; http://n2t.net/addgene:20864 ; RRID:Addgene_20864)
  • For your References section:

    The structural basis of lipopolysaccharide recognition by the TLR4-MD-2 complex. Park BS, Song DH, Kim HM, Choi BS, Lee H, Lee JO. Nature. 2009 Apr 30;458(7242):1191-5. doi: 10.1038/nature07830. Epub 2009 Mar 1. 10.1038/nature07830 PubMed 19252480