pCRISPR-mcBEST
(Plasmid
#209416)
-
PurposePlasmid for multiplexed cytosine base editing in streptomycetes
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209416 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGM1190
- Total vector size (bp) 13213
-
Vector typeCRISPR, Synthetic Biology
-
Selectable markersApramycin
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrowth at 30 C in streptomycetes
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCodon optimized APOBEC1-nCas9-UGI fusion protein
-
Alt namecytosine base editor
-
SpeciesSynthetic
-
GenBank IDnone
- Promoter base editing cassette: PtipA ; sgRNAs: PkasO*
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (unknown if destroyed)
- 3′ cloning site NheI (unknown if destroyed)
- 5′ sequencing primer caacatgctgtgcggtgttg
- 3′ sequencing primer gaccctgatccaccagagca
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namecsy4 from Pseudomonas aeruginosa PAO1
-
SpeciesPseudomonas aeruginosa PAO1
-
GenBank IDWP_003162920.1
- Promoter csy4: PermE*
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer none
- 3′ sequencing primer none
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPR-mcBEST was a gift from Tilmann Weber (Addgene plasmid # 209416 ; http://n2t.net/addgene:209416 ; RRID:Addgene_209416) -
For your References section:
Systems Analysis of Highly Multiplexed CRISPR-Base Editing in Streptomycetes. Whitford CM, Gren T, Palazzotto E, Lee SY, Tong Y, Weber T. ACS Synth Biol. 2023 Aug 18;12(8):2353-2366. doi: 10.1021/acssynbio.3c00188. Epub 2023 Jul 4. 10.1021/acssynbio.3c00188 PubMed 37402223