Skip to main content

pCRISPR-mcBEST
(Plasmid #209416)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209416 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGM1190
  • Total vector size (bp) 13213
  • Vector type
    CRISPR, Synthetic Biology
  • Selectable markers
    Apramycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Apramycin, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Growth at 30 C in streptomycetes
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Codon optimized APOBEC1-nCas9-UGI fusion protein
  • Alt name
    cytosine base editor
  • Species
    Synthetic
  • GenBank ID
    none
  • Promoter base editing cassette: PtipA ; sgRNAs: PkasO*

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site NheI (unknown if destroyed)
  • 5′ sequencing primer caacatgctgtgcggtgttg
  • 3′ sequencing primer gaccctgatccaccagagca
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    csy4 from Pseudomonas aeruginosa PAO1
  • Species
    Pseudomonas aeruginosa PAO1
  • GenBank ID
    WP_003162920.1
  • Promoter csy4: PermE*

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPR-mcBEST was a gift from Tilmann Weber (Addgene plasmid # 209416 ; http://n2t.net/addgene:209416 ; RRID:Addgene_209416)
  • For your References section:

    Systems Analysis of Highly Multiplexed CRISPR-Base Editing in Streptomycetes. Whitford CM, Gren T, Palazzotto E, Lee SY, Tong Y, Weber T. ACS Synth Biol. 2023 Aug 18;12(8):2353-2366. doi: 10.1021/acssynbio.3c00188. Epub 2023 Jul 4. 10.1021/acssynbio.3c00188 PubMed 37402223