Skip to main content

pCRISPR-cBEST-v2-PermE
(Plasmid #209446)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209446 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGM1190
  • Vector type
    CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Apramycin, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    maintenance in streptomycetes at 30 C. Temperature sensitive pSG5 replicon, replication only below 37 C.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Codon optimized APOBEC1-nCas9-UGI fusion protein
  • Alt name
    Cytosine base editor
  • Species
    Synthetic
  • Insert Size (bp)
    5100
  • Promoter PtipA; sgRNA expression from ermE* promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGCTTgcggtcgatcttgacg
  • 3′ sequencing primer TGCTGACCGGATCAGCAGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPR-cBEST-v2-PermE was a gift from Tilmann Weber (Addgene plasmid # 209446 ; http://n2t.net/addgene:209446 ; RRID:Addgene_209446)
  • For your References section:

    Biosynthesis of the Azoxy Compound Azodyrecin from Streptomyces mirabilis P8-A2. Maleckis M, Wibowo M, Gren T, Jarmusch SA, Sterndorff EB, Booth T, Henriksen NNSE, Whitford CM, Jiang X, Jorgensen TS, Ding L, Weber T. ACS Chem Biol. 2024 Feb 10. doi: 10.1021/acschembio.3c00632. 10.1021/acschembio.3c00632 PubMed 38340355