pCRISPR-cBEST-v2-kasOP*
(Plasmid #209447)

• Purpose: improved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the kasOP* promoter
• Depositing Lab: Tilmann Weber
• Publication: Maleckis et al ACS Chem Biol. 2024 Feb 10. doi: 10.1021/acschembio.3c00632.

Backbone

• Vector backbone: pGM1190
• Vector type: CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Apramycin, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: maintenance in streptomycetes at 30 C. Temperature sensitive pSG5 replicon, replication only below 37 C.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Codon optimized APOBEC1-nCas9-UGI fusion protein
• Alt name: Cytosine base editor
• Species: Synthetic
• Insert Size (bp): 5100
• Promoter: PtipA; sgRNA expression from kasOP* promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAacatgctgtgcggtgttg
• 3′ sequencing primer: TGCTGACCGGATCAGCAGTC

Resource Information

• Supplemental Documents:
  • p136_pCRISPR-PkasOP*-CBE_Addgene.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry