LentiCRISPRv2-sgCD20
(Plasmid
#209749)
-
PurposeLentiviral transfer plasmid to express Cas9 and a gRNA targeting the human CD20 gene, MS4A1.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209749 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 52961)
- Backbone size w/o insert (bp) 14873
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMS4A1
-
gRNA/shRNA sequenceGGATCATCAGAAGACCCCCC
-
SpeciesH. sapiens (human)
-
Entrez GeneMS4A1 (a.k.a. B1, Bp35, CD20, CVID5, FMC7, LEU-16, S7)
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Can be used to knockout the human CD20 gene, MS4A1. After which, pCDH-V1-rCD20-BSD, pCDH-V2-rCD20-BSD or pCDH-V3-rCD20-BSD can be used to reconstitute CD20 expression with either variants 1, 2 or 3 mRNA isoforms of CD20.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPRv2-sgCD20 was a gift from Andrei Thomas-Tikhonenko (Addgene plasmid # 209749 ; http://n2t.net/addgene:209749 ; RRID:Addgene_209749) -
For your References section:
Alternative splicing of its 5' UTR limits CD20 mRNA translation and enables resistance to CD20-directed immunotherapies. Ang Z, Paruzzo L, Hayer KE, Schmidt C, Torres-Diz M, Xu F, Zankharia U, Zhang Y, Soldan SS, Zheng S, Falkenstein CD, Loftus JP, Yang SY, Asnani M, King Sainos P, Pillai V, Chong ER, Li M, Tasian SK, Barash Y, Lieberman PM, Ruella M, Schuster SJ, Thomas-Tikhonenko A. Blood. 2023 Sep 8:blood.2023020400. doi: 10.1182/blood.2023020400. 10.1182/blood.2023020400 PubMed 37683180