pLV-NeoR_dCas9-Sniper-KRAB_sgSTK3i_#2 (NeoR)
(Plasmid
#209775)
-
PurposeCRISPRi for STK3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209775 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLV
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-Sniper-KRAB, sgSTK3i
-
Alt namesgMST2i
-
gRNA/shRNA sequenceGTTCCCAGAGTTTCCCTCTG
-
SpeciesH. sapiens (human)
-
Entrez GeneSTK3 (a.k.a. KRS1, MST2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-NeoR_dCas9-Sniper-KRAB_sgSTK3i_#2 (NeoR) was a gift from Michael Wehr (Addgene plasmid # 209775 ; http://n2t.net/addgene:209775 ; RRID:Addgene_209775) -
For your References section:
Comprehensive split TEV based protein-protein interaction screening reveals TAOK2 as a key modulator of Hippo signalling to limit growth. Ma X, Mandausch FJ, Wu Y, Sahoo VK, Ma W, Leoni G, Hostiuc M, Wintgens JP, Qiu J, Kannaiyan N, Rossner MJ, Wehr MC. Cell Signal. 2024 Jan;113:110917. doi: 10.1016/j.cellsig.2023.110917. Epub 2023 Oct 7. 10.1016/j.cellsig.2023.110917 PubMed 37813295