Skip to main content

Stx5S-GFP
(Plasmid #209847)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209847 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    STX5
  • Alt name
    Syntaxin 5
  • Species
    H. sapiens (human)
  • Mutation
    Lacks amino acids 1-54, encodes short isoform of Stx5
  • GenBank ID
    NM_003164.5
  • Entrez Gene
    STX5 (a.k.a. CDG2AA, SED5, STX5A)
  • Promoter CMV
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer TAACAACTCCGCCCCATT
  • 3′ sequencing primer GTCCAGCTCGACCAGGATGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Stx5S-GFP was a gift from Geert van den Bogaart (Addgene plasmid # 209847 ; http://n2t.net/addgene:209847 ; RRID:Addgene_209847)
  • For your References section:

    Congenital disorder of glycosylation caused by starting site-specific variant in syntaxin-5. Linders PTA, Gerretsen ECF, Ashikov A, Vals MA, de Boer R, Revelo NH, Arts R, Baerenfaenger M, Zijlstra F, Huijben K, Raymond K, Muru K, Fjodorova O, Pajusalu S, Ounap K, Ter Beest M, Lefeber D, van den Bogaart G. Nat Commun. 2021 Oct 28;12(1):6227. doi: 10.1038/s41467-021-26534-y. 10.1038/s41467-021-26534-y PubMed 34711829