Bet1L-mCherry
(Plasmid
#209849)
-
PurposeExpresses Bet1L-mCherry in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209849 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmCherry-N1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBet1L
-
Alt nameBET1-like protein
-
Alt nameGS15
-
Alt nameGOS15
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001098787.1
-
Entrez GeneBET1L (a.k.a. BET1L1, GOLIM3, GS15, HSPC197)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer TAACAACTCCGCCCCATT
- 3′ sequencing primer CACCTTGAAGCGCATGAACT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Bet1L-mCherry was a gift from Geert van den Bogaart (Addgene plasmid # 209849 ; http://n2t.net/addgene:209849 ; RRID:Addgene_209849) -
For your References section:
Congenital disorder of glycosylation caused by starting site-specific variant in syntaxin-5. Linders PTA, Gerretsen ECF, Ashikov A, Vals MA, de Boer R, Revelo NH, Arts R, Baerenfaenger M, Zijlstra F, Huijben K, Raymond K, Muru K, Fjodorova O, Pajusalu S, Ounap K, Ter Beest M, Lefeber D, van den Bogaart G. Nat Commun. 2021 Oct 28;12(1):6227. doi: 10.1038/s41467-021-26534-y. 10.1038/s41467-021-26534-y PubMed 34711829