Skip to main content

Bet1L-mCherry
(Plasmid #209849)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209849 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 209849-D50 50 μg of DNA in Tris buffer $495
DNA 209849-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pmCherry-N1
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bet1L
  • Alt name
    BET1-like protein
  • Alt name
    GS15
  • Alt name
    GOS15
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001098787.1
  • Entrez Gene
    BET1L (a.k.a. BET1L1, GOLIM3, GS15, HSPC197)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer TAACAACTCCGCCCCATT
  • 3′ sequencing primer CACCTTGAAGCGCATGAACT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Bet1L-mCherry was a gift from Geert van den Bogaart (Addgene plasmid # 209849 ; http://n2t.net/addgene:209849 ; RRID:Addgene_209849)
  • For your References section:

    Congenital disorder of glycosylation caused by starting site-specific variant in syntaxin-5. Linders PTA, Gerretsen ECF, Ashikov A, Vals MA, de Boer R, Revelo NH, Arts R, Baerenfaenger M, Zijlstra F, Huijben K, Raymond K, Muru K, Fjodorova O, Pajusalu S, Ounap K, Ter Beest M, Lefeber D, van den Bogaart G. Nat Commun. 2021 Oct 28;12(1):6227. doi: 10.1038/s41467-021-26534-y. 10.1038/s41467-021-26534-y PubMed 34711829