Skip to main content

pHR-SIN-BX SpyCatcher003-hCD52
(Plasmid #210565)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210565 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR-SIN
  • Backbone size w/o insert (bp) 10000
  • Total vector size (bp) 10528
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Spycatcher003 fused to human CD52 hinge
  • Alt name
    hCD52-Spycatcher003
  • Species
    Synthetic
  • Insert Size (bp)
    528
  • Promoter SFFV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGGAGACAGACACACTCCTGC
  • 3′ sequencing primer ctaACTGAAGCAGAAGAGGTGGATTATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-SIN-BX SpyCatcher003-hCD52 was a gift from Omer Dushek (Addgene plasmid # 210565 ; http://n2t.net/addgene:210565 ; RRID:Addgene_210565)
  • For your References section:

    Using CombiCells, a platform for titration and combinatorial display of cell surface ligands, to study T-cell antigen sensitivity modulation by accessory receptors. Patel A, Andre V, Eguiguren SB, Barton MI, Burton J, Denham EM, Pettmann J, Morch AM, Kutuzov MA, Siller-Farfan JA, Dustin ML, van der Merwe PA, Dushek O. EMBO J. 2024 Jan;43(1):132-150. doi: 10.1038/s44318-023-00012-1. Epub 2023 Dec 18. 10.1038/s44318-023-00012-1 PubMed 38177315