pHR-SIN-BX SpyCatcher003-hCD52
(Plasmid
#210565)
-
PurposeExpresses Spycatcher003 on the cell surface using human CD52 hinge
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210565 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR-SIN
- Backbone size w/o insert (bp) 10000
- Total vector size (bp) 10528
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpycatcher003 fused to human CD52 hinge
-
Alt namehCD52-Spycatcher003
-
SpeciesSynthetic
-
Insert Size (bp)528
- Promoter SFFV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGAGACAGACACACTCCTGC
- 3′ sequencing primer ctaACTGAAGCAGAAGAGGTGGATTATGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.06.15.545075v2 for bioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-SIN-BX SpyCatcher003-hCD52 was a gift from Omer Dushek (Addgene plasmid # 210565 ; http://n2t.net/addgene:210565 ; RRID:Addgene_210565) -
For your References section:
Using CombiCells, a platform for titration and combinatorial display of cell surface ligands, to study T-cell antigen sensitivity modulation by accessory receptors. Patel A, Andre V, Eguiguren SB, Barton MI, Burton J, Denham EM, Pettmann J, Morch AM, Kutuzov MA, Siller-Farfan JA, Dustin ML, van der Merwe PA, Dushek O. EMBO J. 2024 Jan;43(1):132-150. doi: 10.1038/s44318-023-00012-1. Epub 2023 Dec 18. 10.1038/s44318-023-00012-1 PubMed 38177315