U6-CjCas9-MS2gRNA-Backbone
(Plasmid
#210711)
-
PurposeThis plasmid express MS2 loop containing Cj Cas9 gRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210711 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC57
-
Backbone manufacturerGenescript
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMS2 loop containing Cj Cas9 gRNA
-
gRNA/shRNA sequenceNA - Empty Backbone
-
Speciesbacteriophage MS2
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gagggcctatttcccatgat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Stbl3 is also a suitable growth strain.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
U6-CjCas9-MS2gRNA-Backbone was a gift from Isaac Hilton (Addgene plasmid # 210711 ; http://n2t.net/addgene:210711 ; RRID:Addgene_210711) -
For your References section:
Compact engineered human mechanosensitive transactivation modules enable potent and versatile synthetic transcriptional control. Mahata B, Cabrera A, Brenner DA, Guerra-Resendez RS, Li J, Goell J, Wang K, Guo Y, Escobar M, Parthasarathy AK, Szadowski H, Bedford G, Reed DR, Kim S, Hilton IB. Nat Methods. 2023 Oct 9. doi: 10.1038/s41592-023-02036-1. 10.1038/s41592-023-02036-1 PubMed 37813990