Skip to main content

pKM427
(Plasmid #210788)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210788 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDE43-MCZ
  • Backbone manufacturer
    Dirk Schnappinger
  • Backbone size w/o insert (bp) 3592
  • Total vector size (bp) 4818
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Defective hygromycin resistant gene
  • Species
    Synthetic
  • Insert Size (bp)
    1226
  • Mutation
    Changed hygromycin resistant gene W190 codon (TGG) to stop codon TAG.

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site PvuI (not destroyed)
  • 5′ sequencing primer CCTGGTATCTTTATAGTCCTGTCG
  • 3′ sequencing primer AATAGACCGGGACAAGGTTGCACC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Defective hygromycin-resistant gene was generated by overlap PCR and cloned into the PvuI-HindIII sites of pDE43-MCZ, a mycobacterial phage L5 integrating vector.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKM427 was a gift from Kenan Murphy (Addgene plasmid # 210788 ; http://n2t.net/addgene:210788 ; RRID:Addgene_210788)
  • For your References section:

    Oligo-Mediated Recombineering and its Use for Making SNPs, Knockouts, Insertions, and Fusions in Mycobacterium tuberculosis. Murphy KC. Methods Mol Biol. 2021;2314:301-321. doi: 10.1007/978-1-0716-1460-0_14. 10.1007/978-1-0716-1460-0_14 PubMed 34235660
Commonly requested with: