pBABE-puro-mouse Oct4
(Plasmid
#21110)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21110 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBABE-puro
- Backbone size w/o insert (bp) 5169
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameOct4
-
Alt namePou5f1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1059
-
Entrez GenePou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer gcctcaatcctccctttatcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBABE-puro-mouse Oct4 was a gift from Dean Tantin (Addgene plasmid # 21110 ; http://n2t.net/addgene:21110 ; RRID:Addgene_21110) -
For your References section:
A general mechanism for transcription regulation by Oct1 and Oct4 in response to genotoxic and oxidative stress. Kang J, Gemberling M, Nakamura M, Whitby FG, Handa H, Fairbrother WG, Tantin D. Genes Dev. 2009 Jan 15. 23(2):208-22. 10.1101/gad.1750709 PubMed 19171782