Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBABE-puro-mouse Oct4
(Plasmid #21110)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21110 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBABE-puro
  • Backbone size w/o insert (bp) 5169
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Oct4
  • Alt name
    Pou5f1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1059
  • Entrez Gene
    Pou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer gcctcaatcctccctttatcc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBABE-puro-mouse Oct4 was a gift from Dean Tantin (Addgene plasmid # 21110 ; http://n2t.net/addgene:21110 ; RRID:Addgene_21110)
  • For your References section:

    A general mechanism for transcription regulation by Oct1 and Oct4 in response to genotoxic and oxidative stress. Kang J, Gemberling M, Nakamura M, Whitby FG, Handa H, Fairbrother WG, Tantin D. Genes Dev. 2009 Jan 15. 23(2):208-22. 10.1101/gad.1750709 PubMed 19171782