pUC19-Top2A-5X Gly-Venus-T2A-Hygro
(Plasmid
#211115)
-
PurposeFor tagging the C-term of Top2A with Venus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211115 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC19
-
Backbone manufacturerThermoFisher
- Backbone size w/o insert (bp) 2686
- Total vector size (bp) 6562
-
Modifications to backbonenone
-
Vector typeMammalian Expression, Bacterial Expression, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert name5' C-term Top2A homology arm
-
SpeciesH. sapiens (human)
-
Insert Size (bp)800
-
GenBank IDNG_027678.1
-
Entrez GeneTOP2A (a.k.a. TOP2, TOP2alpha, TOPIIA, TP2A)
- Promoter n/a
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer aacaattcatctaagagtgg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameVenus
-
SpeciesAequorea victoria
-
Insert Size (bp)720
- Promoter n/a
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGTGAGCAAGGGCGAGGA (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameT2A
-
SpeciesSynthetic
-
Insert Size (bp)57
- Promoter n/a
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGGCAGAGGAAGTCTGCT (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameBlastocidin Resistance
-
SpeciesBacillus cereus
-
Insert Size (bp)987
- Promoter n/a
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGAAAAAGCCTGAACTCAC (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert name5' C-term Top2A homology arm
-
SpeciesH. sapiens (human)
-
Insert Size (bp)800
-
GenBank IDNG_027678.1
-
Entrez GeneTOP2A (a.k.a. TOP2, TOP2alpha, TOPIIA, TP2A)
- Promoter n/a
Cloning Information for Gene/Insert 5
- Cloning method Gibson Cloning
- 5′ sequencing primer TAAAATGTGAGGCGATTATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19-Top2A-5X Gly-Venus-T2A-Hygro was a gift from Job Dekker (Addgene plasmid # 211115 ; http://n2t.net/addgene:211115 ; RRID:Addgene_211115) -
For your References section:
Mitotic chromosomes are self-entangled and disentangle through a topoisomerase-II-dependent two-stage exit from mitosis. Hildebrand EM, Polovnikov K, Dekker B, Liu Y, Lafontaine DL, Fox AN, Li Y, Venev SV, Mirny LA, Dekker J. Mol Cell. 2024 Mar 13:S1097-2765(24)00144-8. doi: 10.1016/j.molcel.2024.02.025. 10.1016/j.molcel.2024.02.025 PubMed 38521067