Skip to main content

pcDNA3-ApaLID211A-HA
(Plasmid #211459)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211459 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5530
  • Total vector size (bp) 6704
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ApaLI-D211A
  • Insert Size (bp)
    1172
  • Mutation
    D211A
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Ampicillin or Kanamycin may be used as bacterial resistance.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-ApaLID211A-HA was a gift from Agnel Sfeir (Addgene plasmid # 211459 ; http://n2t.net/addgene:211459 ; RRID:Addgene_211459)
  • For your References section:

    Mitochondrial DNA breaks activate an integrated stress response to reestablish homeostasis. Fu Y, Sacco O, DeBitetto E, Kanshin E, Ueberheide B, Sfeir A. Mol Cell. 2023 Oct 8:S1097-2765(23)00753-0. doi: 10.1016/j.molcel.2023.09.026. 10.1016/j.molcel.2023.09.026 PubMed 37832546