pcDNA3-ApaLID211A-HA
(Plasmid
#211459)
-
PurposeExpress mitochondrial localized ApaLI with D211A mutation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 211459 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5530
- Total vector size (bp) 6704
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameApaLI-D211A
-
Insert Size (bp)1172
-
MutationD211A
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Ampicillin or Kanamycin may be used as bacterial resistance.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-ApaLID211A-HA was a gift from Agnel Sfeir (Addgene plasmid # 211459 ; http://n2t.net/addgene:211459 ; RRID:Addgene_211459) -
For your References section:
Mitochondrial DNA breaks activate an integrated stress response to reestablish homeostasis. Fu Y, Sacco O, DeBitetto E, Kanshin E, Ueberheide B, Sfeir A. Mol Cell. 2023 Oct 8:S1097-2765(23)00753-0. doi: 10.1016/j.molcel.2023.09.026. 10.1016/j.molcel.2023.09.026 PubMed 37832546