-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21146 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepREP3X
- Backbone size w/o insert (bp) 8754
-
Vector typeYeast Expression ; S. pombe
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTEV protease
-
Speciestobacco etch virus
-
Insert Size (bp)1176
-
GenBank IDAAA47909
-
Entrez GeneTEVgp1 (a.k.a. TEVgp1)
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- myc (N terminal on insert)
- 2xNLS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site SmaI (not destroyed)
- 5′ sequencing primer TCACTTTCTGACTTATAGTCGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byF Uhlmann, K Nasmyth
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
plasmid modified from one used to express TEV protease in S. cerevisiae
Some mismatches between Addgene QC sequence and author-provided sequence, but author has determined that TEV expression would not be affected.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pREP3-TEV-NLS was a gift from Stephen Kearsey (Addgene plasmid # 21146 ; http://n2t.net/addgene:21146 ; RRID:Addgene_21146) -
For your References section:
Nuclear distribution and chromatin association of DNA polymerase alpha-primase is affected by TEV protease cleavage of Cdc23 (Mcm10) in fission yeast. Yang X, Gregan J, Lindner K, Young H, Kearsey SE. BMC Mol Biol. 2005 . 6():13. 10.1186/1471-2199-6-13 PubMed 15941470