Skip to main content
Addgene

pREP3-TEV-NLS
(Plasmid #21146)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21146 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pREP3X
  • Backbone size w/o insert (bp) 8754
  • Vector type
    Yeast Expression ; S. pombe
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TEV protease
  • Species
    tobacco etch virus
  • Insert Size (bp)
    1176
  • GenBank ID
    AAA47909
  • Entrez Gene
    TEVgp1 (a.k.a. TEVgp1)
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • myc (N terminal on insert)
    • 2xNLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SmaI (not destroyed)
  • 5′ sequencing primer TCACTTTCTGACTTATAGTCGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    F Uhlmann, K Nasmyth

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

plasmid modified from one used to express TEV protease in S. cerevisiae

Some mismatches between Addgene QC sequence and author-provided sequence, but author has determined that TEV expression would not be affected.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pREP3-TEV-NLS was a gift from Stephen Kearsey (Addgene plasmid # 21146 ; http://n2t.net/addgene:21146 ; RRID:Addgene_21146)
  • For your References section:

    Nuclear distribution and chromatin association of DNA polymerase alpha-primase is affected by TEV protease cleavage of Cdc23 (Mcm10) in fission yeast. Yang X, Gregan J, Lindner K, Young H, Kearsey SE. BMC Mol Biol. 2005 Jun 7;6:13. doi: 10.1186/1471-2199-6-13. 10.1186/1471-2199-6-13 PubMed 15941470