pLenti_Cas9_T2A_mNeonGreen_P2A_blasticidin
(Plasmid #211471)

• Purpose: lentiviral tricistronic complex expressing Cas9, mNeonGreen, and blasticidin resistance
• Depositing Lab: James Eshleman
• Publication: Teh et al bioRxiv. 2023 Oct 10:2023.04.15.537042. doi: 10.1101/2023.04.15.537042. Preprint.

Backbone

• Vector backbone: pLentiCas9-T2A-GFP
• Backbone manufacturer: Addgene 78548
• Total vector size (bp): 13724
• Modifications to backbone: Replaced GFP with mNeonGreen
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cas9_T2A_mNeonGreen_P2A_BlasticidinR
• Species: Synthetic
• Insert Size (bp): 5426
• Promoter: hU6, EF-1a
• Tag / Fusion Protein:
  • 3xFlag

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: agcagagagaagtttgttgc
• 3′ sequencing primer: gggcagagcgcacatcgccc

Resource Information

• Supplemental Documents:
  • Teh_p9m_6_pLenti_Cas9_T2A-mNeonGreen-Blasticidin-3_pLann.gbk
• A portion of this plasmid was derived from a plasmid made by: mNeonGreen was amplified from Addgene plasmid 122183

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2023.04.15.537042 for bioRxiv preprint.