Skip to main content

human oct4-GFP
(Plasmid #21153)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21153 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 21153-D50 50 μg of DNA in Tris buffer $495
DNA 21153-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    BluescriptKSII
  • Backbone manufacturer
    stratagene
  • Backbone size w/o insert (bp) 2381
  • Vector type
    Mammalian Expression ; human targeting
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Growth instructions
    XL1blue
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hOCT4-GFP
  • Alt name
    hCol1a1 targeting arms
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    120006
  • Entrez Gene
    POU5F1 (a.k.a. OCT3, OCT4, OCT4Borf1, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGATAAGCTTGGTACCGAGC
  • 3′ sequencing primer CCAACACACTATTGCAATGAAA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    human oct4-GFP was a gift from Rudolf Jaenisch (Addgene plasmid # 21153 ; http://n2t.net/addgene:21153 ; RRID:Addgene_21153)
  • For your References section:

    Nanoparticles for gene transfer to human embryonic stem cell colonies. Green JJ, Zhou BY, Mitalipova MM, Beard C, Langer R, Jaenisch R, Anderson DG. Nano Lett. 2008 Oct . 8(10):3126-30. 10.1021/nl8012665 PubMed 18754690