-
Depositing Lab
-
Depositing OrganizationWhitehead Institute for Biomedical Research
Located in the United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21153 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 21153-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 21153-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneBluescriptKSII
-
Backbone manufacturerstratagene
- Backbone size w/o insert (bp) 2381
-
Vector typeMammalian Expression ; human targeting
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Growth instructionsXL1blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehOCT4-GFP
-
Alt namehCol1a1 targeting arms
-
SpeciesH. sapiens (human)
-
Insert Size (bp)120006
-
Entrez GenePOU5F1 (a.k.a. OCT3, OCT4, OCT4Borf1, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CGATAAGCTTGGTACCGAGC
- 3′ sequencing primer CCAACACACTATTGCAATGAAA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 21153-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 21153-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
human oct4-GFP was a gift from Rudolf Jaenisch (Addgene plasmid # 21153 ; http://n2t.net/addgene:21153 ; RRID:Addgene_21153) -
For your References section:
Nanoparticles for gene transfer to human embryonic stem cell colonies. Green JJ, Zhou BY, Mitalipova MM, Beard C, Langer R, Jaenisch R, Anderson DG. Nano Lett. 2008 Oct . 8(10):3126-30. 10.1021/nl8012665 PubMed 18754690