CHFR-PBZ-eGFP
(Plasmid
#211581)
-
PurposeExpressing CHFR PBZ domain fused to eGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211581 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCHFR PBZ domain
-
SpeciesH. sapiens (human)
-
MutationPBZ domain of the protein
-
Entrez GeneCHFR (a.k.a. RNF116, RNF196)
- Promoter CMV
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
N451S and V480M mutations in CHFR PBZ domain do not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CHFR-PBZ-eGFP was a gift from Chris Lord (Addgene plasmid # 211581 ; http://n2t.net/addgene:211581 ; RRID:Addgene_211581) -
For your References section:
The ubiquitin-dependent ATPase p97 removes cytotoxic trapped PARP1 from chromatin. Krastev DB, Li S, Sun Y, Wicks AJ, Hoslett G, Weekes D, Badder LM, Knight EG, Marlow R, Pardo MC, Yu L, Talele TT, Bartek J, Choudhary JS, Pommier Y, Pettitt SJ, Tutt ANJ, Ramadan K, Lord CJ. Nat Cell Biol. 2022 Jan;24(1):62-73. doi: 10.1038/s41556-021-00807-6. Epub 2022 Jan 10. 10.1038/s41556-021-00807-6 PubMed 35013556