pEJS-HZ96 AAV-SpABE8e-N-terminus_tracrRNA
(Plasmid
#211817)
-
PurposeAAV vector expressing N-terminal of SpCas9-ABE8e and tracrRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 211817 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV backbone
- Backbone size w/o insert (bp) 3097
- Total vector size (bp) 7460
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameN-terminus of SpCas9-ABE8e and tracrRNA
-
SpeciesSynthetic
-
Insert Size (bp)4395
- Promoter chicken β-actin promoter and U6 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cagggtacccgttacataact
- 3′ sequencing primer gcggccgcgagggcctatttccca (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.03.20.533459 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEJS-HZ96 AAV-SpABE8e-N-terminus_tracrRNA was a gift from Erik Sontheimer (Addgene plasmid # 211817 ; http://n2t.net/addgene:211817 ; RRID:Addgene_211817) -
For your References section:
Self-delivering, chemically modified CRISPR RNAs for AAV co-delivery and genome editing in vivo. Zhang H, Kelly K, Lee J, Echeverria D, Cooper D, Panwala R, Amrani N, Chen Z, Gaston N, Wagh A, Newby GA, Xie J, Liu DR, Gao G, Wolfe SA, Khvorova A, Watts JK, Sontheimer EJ. Nucleic Acids Res. 2023 Nov 30:gkad1125. doi: 10.1093/nar/gkad1125. 10.1093/nar/gkad1125 PubMed 38033325